View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_low_46 (Length: 285)
Name: NF14684_low_46
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 121 - 280
Target Start/End: Complemental strand, 22790877 - 22790725
Alignment:
| Q |
121 |
ataaaaagtttgagagaatattaagctagggtatgaannnnnnncaaatttaggatacaatacagtttggatcagttaacaaaattaatttatattctga |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22790877 |
ataaaaagtttgagagaatattaagctagggtatgaatttttttcaaatttaggatacaatacagtttggatccgttaacaaaattaatttatattctga |
22790778 |
T |
|
| Q |
221 |
agagtatcaggatgtcttggaaaatatatgtagaatatcaataaagtttaat-gaaaaaat |
280 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22790777 |
agagta--------tcctggaaaatatatgtagaatatcaataaagtttaatagaaaaaat |
22790725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 24 - 100
Target Start/End: Original strand, 37240387 - 37240463
Alignment:
| Q |
24 |
ggggttttgagatatttttcttggtgtttctatgtacaatttcttattttattctgtagcaaaacttgggtttgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37240387 |
ggggttttgagatatttttcttggtgtttctatgtacaatttcttattttattctgtagcaaaacttgggtttgaat |
37240463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University