View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_low_67 (Length: 222)
Name: NF14684_low_67
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_low_67 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 2812525 - 2812339
Alignment:
| Q |
15 |
cataggcacatattggagaccttttatttgggtgtgttgcttcaagaagattgactattgtagggacatttctaggggcatgaatgcaaaccagcaccct |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2812525 |
cataagcacatattggagaccttttatttgggtgtgttgcttcaagaagattgactattgtagggacatttctaggggcatgaatgcaaaccagcaccct |
2812426 |
T |
 |
| Q |
115 |
taactcagcatcaactcttgaactttgcactgttctttttctgtagggtatgagtcttttccttggcctatagattaatgccacaat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2812425 |
taactcagcatcaactcttgaactttgcactgttctttttctgtagggtatgagtcttttccttggcctatagattaatgccacaat |
2812339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University