View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_low_68 (Length: 217)
Name: NF14684_low_68
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_low_68 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 15 - 140
Target Start/End: Complemental strand, 1845032 - 1844907
Alignment:
| Q |
15 |
acttcatccatttagtcaattgtattcataattatatgaggtcgtgttagcaaagttctaaattttagttgtaaaactcannnnnnncatacgaactata |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1845032 |
acttcatccatttagtcaattgtattcataagtatatgaggtcgtgttagcaaagttctaaattttagttgtaaaactcatttttctcatacgaactata |
1844933 |
T |
 |
| Q |
115 |
tggacttgtattggaacaagcattca |
140 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1844932 |
tggacttgtattggaacaagcattca |
1844907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 1819592 - 1819508
Alignment:
| Q |
15 |
acttcatccatttagtcaattgtattcata-----attatatgaggtcgtgttagcaaagttctaaattttagttgtaaaactca |
94 |
Q |
| |
|
|||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1819592 |
acttcatccatttagtcaattgcattcataagtatatgatatgaggtcgtgttagcaaagttctaaattttagttgtaaaactca |
1819508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University