View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_low_73 (Length: 211)
Name: NF14684_low_73
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_low_73 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 40946711 - 40946501
Alignment:
| Q |
1 |
gtacatatagatttagtttttcttttgaagcaatacatatatatttagttaaacatattttattttgttataatatatcttcaccaatattatgtttgac |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40946711 |
gtacatatagatttagttttccttttgaagcaatacatatatatttagttaaacatattttattttgttataatatattttcaccaatattatgtttgac |
40946612 |
T |
|
| Q |
101 |
atcgacaattaaccaatgcaaaattttatcaaatctttatgataaaccaaattcgtaatagtgtag----atgttaggttgttgtctagaagcaacatga |
196 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40946611 |
atcgac----aaccaatgcaaaattttatcaaatctttatgataaaccaaattcgtaatagtgtagatgcatgttaggttgttgtttagaagcaacatga |
40946516 |
T |
|
| Q |
197 |
tgtgtagctcgagta |
211 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
40946515 |
tgtatagctcgagta |
40946501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 40947222 - 40947171
Alignment:
| Q |
1 |
gtacatatagatttagtttttcttttgaagcaatacatatatatttagttaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40947222 |
gtacatatagatttagtttttcttttgaagcaatccatatatatttagttaa |
40947171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University