View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_low_77 (Length: 201)
Name: NF14684_low_77
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_low_77 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 15 - 111
Target Start/End: Original strand, 41836750 - 41836846
Alignment:
| Q |
15 |
aattttgaggttggatttgtgcggaaaaatatctgaatatatccccttctcagttatgcttaatgttcaacagatgctctggagtttgtttcttttc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
41836750 |
aattttgaggttggatttgtgcggaaaaatatctgaatatatccccttctcagttatgcttaaggttcaacagatgctctgaagtttgtttcttttc |
41836846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 126 - 183
Target Start/End: Original strand, 41836839 - 41836896
Alignment:
| Q |
126 |
ttcttttctagtcaaacaaaaactcgaagccaatcaaaaagtatcattattattcaat |
183 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41836839 |
ttcttttctagtcaaacaaaaactggaagccaatcaaaaagtatcattattattcaat |
41836896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University