View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14685_high_5 (Length: 272)
Name: NF14685_high_5
Description: NF14685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14685_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 263
Target Start/End: Complemental strand, 33170789 - 33170542
Alignment:
| Q |
16 |
agtcctggtgttcaaactataactagacccttactcatcattacattattcaatttgatacattgtgaatgatttgtgttgtccacaggcagatcatctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33170789 |
agtcctggtgttcaaactataactagacccttactcatcattacattattcaatttgatacattgtgaatgatttgtgttgtccacaggcagatcatctc |
33170690 |
T |
 |
| Q |
116 |
aggcagcaaactctgatacacatgtcccgcatcctgtctacacaccaagctgctaggggcttgattgctcttggggaatactttcatcgccttcgtacta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33170689 |
aggcagcaaactctgatacacatgtcccgcatcctgtctacgcaccaagctgctaggggcttgattgctctaggggaatactttcatcgccttcgtacta |
33170590 |
T |
 |
| Q |
216 |
tttgttctctctggacttctcgtccattcgattccatgaggtcaccta |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33170589 |
tttgttctctctggacttctcgtccattcgattccatgaggtcaccta |
33170542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University