View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14685_low_10 (Length: 252)
Name: NF14685_low_10
Description: NF14685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14685_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 36043103 - 36043317
Alignment:
| Q |
13 |
aatatgaataaattactttagctaccatatgatgaaaaatataatttgtattggtattgttgcgattcaatattattttaacaagtaatattattgtaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36043103 |
aatatgaataaattactttagctaccatatgatgaaaaatataatttgtattggtattgttgcgattcaatattattttaacaagtaatattattgtaat |
36043202 |
T |
 |
| Q |
113 |
tctttnnnnnnnnnnnnggtaatattattgtaaaataagttgttagacatttgta-----------gcaatataatcatatagttgatagaaacttgatt |
201 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
36043203 |
tcttt---caataaaaaggtaattttattgtaaaataagttgttagacatttgtagcaatcccaatgcaatgtaatcatataattgatagaaacttgatt |
36043299 |
T |
 |
| Q |
202 |
ttaaactggttttcaaat |
219 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36043300 |
ttaaactggttttcaaat |
36043317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University