View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14685_low_11 (Length: 242)
Name: NF14685_low_11
Description: NF14685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14685_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 28 - 223
Target Start/End: Complemental strand, 46661424 - 46661224
Alignment:
| Q |
28 |
aattgaaaagaaattaaagccatgtgtattaatagttctttggattaaaaagaagattgaaatgtttgcacttctgacatgggtttaaggtgcagttgtt |
127 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46661424 |
aattgaaaagaaattaaaggcatgtgtattaatagttttttggattaaagagaagattgaaatgtttgcacttctgacatgggtttaaggtgcagttttt |
46661325 |
T |
 |
| Q |
128 |
gcaggtggctagatttaacccaagaagtaacattattgcaatgtt----ttttgccacttttgtttggtg-aaaaattatatgaattttgaaaacttagt |
222 |
Q |
| |
|
|||| ||||||||||||||| || |||| |||||||||||||||| ||||| ||||||||||||||| |||||| ||||||||||||||| |||||| |
|
|
| T |
46661324 |
gcagatggctagatttaaccaaaaaagtgacattattgcaatgttttttttttgtcacttttgtttggtgaaaaaataatatgaattttgaaagcttagt |
46661225 |
T |
 |
| Q |
223 |
g |
223 |
Q |
| |
|
| |
|
|
| T |
46661224 |
g |
46661224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University