View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14685_low_5 (Length: 300)
Name: NF14685_low_5
Description: NF14685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14685_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 24 - 288
Target Start/End: Original strand, 48861829 - 48862100
Alignment:
| Q |
24 |
aggccacatattctcatcattgttataattagtcttgttctat-gcataatcattatatctcatcaatattccttaatagctt---cgacactccaactt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48861829 |
aggccacatattctcatcattgttataattagtcttgttctattgcataatcattatatctcatcaatattccttaatagctttaccgacactccaactt |
48861928 |
T |
 |
| Q |
120 |
taaatctcaacttgagatttgaaagtactgcgaagtagcaattgtgttttgaaaattgggggtatgaacatcatcaactgcatcatcaacaa---tgtgt |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
48861929 |
ttaatctcaacttgagatttgaaagtactgcgaagtagcaattgtgttttgaaaattgggggtatgagcatcatcaactgcatcatcaacaatgttgtgt |
48862028 |
T |
 |
| Q |
217 |
gaatatggagtataataacttaaatatcttttatctttacccgaaagataaaacaaagttggcatattcttc |
288 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48862029 |
gaatatggagtataataacttaaatatgttttatctttacccgaaagataaaacaaagttggcattttcttc |
48862100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University