View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14685_low_7 (Length: 278)
Name: NF14685_low_7
Description: NF14685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14685_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 27133700 - 27133912
Alignment:
| Q |
18 |
taaacaatcaaaacaatttagtaatgtcattgttaaaaacaattaaatttagtgtctcttaagtacaaattatatgatnnnnnnntgtgaaagatatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||| |
|
|
| T |
27133700 |
taaacaatcaaaacaatttagtaatgtcattgtttaaaacaattaaatttagtgtctcttaagaacaaattatatgataaaaaaatgtg-aagatatttg |
27133798 |
T |
|
| Q |
118 |
acgtgagttcaaaccttctacgtttattttctccacacttaatatgtggaagtttcgttaagtgaactcttc-aaaacatgaaaaatgaaatttaatgac |
216 |
Q |
| |
|
|| ||||||||||||| ||||||||||||||| |||| ||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27133799 |
acctgagttcaaacctactacgtttattttcttcacatttaatgtgtgtaagtttcgttaagtgaactcttcaaaaacatgaaaaatgaaatttaatgac |
27133898 |
T |
|
| Q |
217 |
aaaacataagtgaa |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27133899 |
aaaacataagtgaa |
27133912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University