View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14686_high_5 (Length: 215)
Name: NF14686_high_5
Description: NF14686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14686_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 1375989 - 1375810
Alignment:
| Q |
20 |
atttagaaggttaacattttcaaatgtgcccaaatgataggtagtaataattaaagaatgtaagaaaatattaaaccaaataccacctaactagaatgac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1375989 |
atttagaaggttaacattttcaaatgtgcccaaatgataggtagtaataattaaagaatgtaagaaaatattaaaccaaataccacctaactagaatgac |
1375890 |
T |
|
| Q |
120 |
ttattagttgaagagtatttgtccatgtagtaaccactcttttgttcgtttgtgtaagggtgactcgtgtagtgtctctg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1375889 |
ttattagttgaagagtatttgtccatgtagtaaccactcttttgttcgtttgtgtaagggtgactcgtgtagtgtctctg |
1375810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University