View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14689_high_23 (Length: 227)
Name: NF14689_high_23
Description: NF14689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14689_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 5970172 - 5970381
Alignment:
| Q |
14 |
attgattttgatcgatatttattaatgagttatgttaattgagagactaaattgactagtgttgttgaatttaagtgactaattttctagctaagaattt |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5970172 |
attgattttgatcgatatttactaatgagatatgttaattgagagactaaattgattggtgttgttgaatttaagtgactaattttctagctaagaattt |
5970271 |
T |
 |
| Q |
114 |
taatggatcaaattgttcaatccttgaagatcgaaatgttgatttacttaattaagttgatatagaactttaatttgaaaatatagtacatattaggaag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5970272 |
taatggatcaaattgttcaatccttgaagatcgaattgttgatttacttaattaagttgatatagaactttaatttgaaaatatagtacatattaggaag |
5970371 |
T |
 |
| Q |
214 |
cttcattgtg |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
5970372 |
cttcattgtg |
5970381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University