View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14689_low_16 (Length: 297)
Name: NF14689_low_16
Description: NF14689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14689_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 15 - 169
Target Start/End: Original strand, 25047096 - 25047252
Alignment:
| Q |
15 |
atatgttatttaagatactttacacaagtttatgcaatgcttgctgccgcgtaattc----tcaatggtaaaaataaaatgttaagctacggtttaatgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
25047096 |
atatgttatttaagatactttacacaagtttatgcaatgcttgctgccgcgtaattccttctcaatggtaaaaa--atatgttaagctacggtttaatgt |
25047193 |
T |
|
| Q |
111 |
gttttatgcaacctttaaatactttcattaaagatgctctaattataccatacttttta |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25047194 |
gttttatgcaacctttaaatactttcattaaagatgctctaattataccatacttttta |
25047252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 161 - 279
Target Start/End: Original strand, 25047471 - 25047589
Alignment:
| Q |
161 |
tactttttattatgaagcgaaaaatgtagaagagtttgtgattgtgaaaaagacctttgaccacaatcctacaacagatttatttatggtcctagttcta |
260 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25047471 |
tactttttattatgaagcgaagaatgtagaagagtttctgattgtgaaaaagacctttgaccacaatcctacaacagatttatttatggtcctagttcta |
25047570 |
T |
|
| Q |
261 |
cactacgtaccatgtaggt |
279 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25047571 |
cactacgtaccatgtaggt |
25047589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University