View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14689_low_19 (Length: 267)
Name: NF14689_low_19
Description: NF14689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14689_low_19 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 267
Target Start/End: Complemental strand, 11485018 - 11484759
Alignment:
| Q |
8 |
tacggtctcttctacgctgctttggatataaaagctggttcgtttgccgcggttcttacctttctttgctgggttggtgctagtttcgtcgctaaatcca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11485018 |
tacggtctcttctacgctgctttggatataaaagctggttcgtttgccgcggttcttacctttctttgctgggttggtgctagtttcgtcgctaaatcca |
11484919 |
T |
 |
| Q |
108 |
tcggctacgaacttgcttggaaggtactttgatgtcttacataaataactatatattaagaatgccatgaggcatatggaaaagtacattgttctaattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11484918 |
tcggctacgaacttgcttggaaggtactttgatgtcttacataaataactatatattaagaatgccatgaggcatatggaaaagtacattgttctaattt |
11484819 |
T |
 |
| Q |
208 |
acaaaaatctgttgtgacttaattatttttgattatgatcttgcaggttgtgttggctac |
267 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
11484818 |
acaaaaatctgctgtgacataattatttttgactatgatctttcaggttgtgttggctac |
11484759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 8 - 136
Target Start/End: Complemental strand, 11472887 - 11472759
Alignment:
| Q |
8 |
tacggtctcttctacgctgctttggatataaaagctggttcgtttgccgcggttcttacctttctttgctgggttggtgctagtttcgtcgctaaatcca |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| ||| | ||||||||||| ||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
11472887 |
tacggtcttttctacgctgctttggatattaaagctggttcttttacggcggttcttacttttctttcttgggttggtgctagtttcgtcgctaattcca |
11472788 |
T |
 |
| Q |
108 |
tcggctacgaacttgcttggaaggtactt |
136 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
11472787 |
tcggctacgaactcgcttggaaggtactt |
11472759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 11502152 - 11502107
Alignment:
| Q |
8 |
tacggtctcttctacgctgctttggatataaaagctggttcgtttg |
53 |
Q |
| |
|
|||| ||| |||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
11502152 |
tacgctcttttctacgctgctttggatattaaagctggttcctttg |
11502107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University