View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14689_low_20 (Length: 263)
Name: NF14689_low_20
Description: NF14689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14689_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 14 - 258
Target Start/End: Complemental strand, 30684241 - 30683997
Alignment:
| Q |
14 |
agatcctctatgtgaaatgtagttatatgttggcataataacactgcatcaaactcggctactgtcaaattccaaaatcctgatcccgacgagggaccat |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30684241 |
agatcctctatgtgaaatgtagttaaatgttggcataataacactgcatcgaactcggctactgtcaaattccaaaatcctgatcccgacgtgggaccat |
30684142 |
T |
 |
| Q |
114 |
catacttcagaaaaagatctttcctataaatattgatcagcagtggctttgatgcatttaaatttcgaagagcagcaaaattcttactatttgtactgac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30684141 |
catacttcagaaaaagatctttcctataaatattgatcagcagcggctttgatgcatttaaatttcgaagaccagcaaaattcttactatttgtactgac |
30684042 |
T |
 |
| Q |
214 |
cgacccagttttggcgtcaacttgaaacgaagtgattttcttgga |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30684041 |
cgacccagttttggcgtcaacttgaaacgaagtgatttttttgga |
30683997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University