View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14689_low_25 (Length: 211)
Name: NF14689_low_25
Description: NF14689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14689_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 48013067 - 48013184
Alignment:
| Q |
1 |
ccaataaaaagatttgataaggtacattacaaacctgattcgcaacacaaataaggnnnnnnntatatcatgctattttgaatataaacggtgcatagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48013067 |
ccaataaaaagatttgataaggtacattacaaacctgattcgcagcacaaataaggaaaaaaacatatcatgctattttgaatataaacggtgcatagtg |
48013166 |
T |
|
| Q |
101 |
tttggcatagtatgtggt |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48013167 |
tttggcatagtatgtggt |
48013184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University