View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14689_low_8 (Length: 378)
Name: NF14689_low_8
Description: NF14689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14689_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 14 - 354
Target Start/End: Complemental strand, 41073478 - 41073138
Alignment:
| Q |
14 |
aaaatcacttcttatgaaatttcttttctagactatcattggtgggacattggtccatttgttatttggatgactttcattggaaggggttaattcttcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
41073478 |
aaaatcacttcttatgaaatttcttttctagactattattggtgggacattggtccatttgttattaggatgactttcattggaagggattaattcttcc |
41073379 |
T |
 |
| Q |
114 |
aaagttttggtttcaaaggctagagttttggtttcgtctcccctcacctttttgttcttttttctttatttatataatatattattagtgtgttgttgat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41073378 |
aaagttttggtttcaaaggctagagttttggtttcgtctcccctcgcctttttgttcttttttctttatttatataatatattattagtgtgttgttgat |
41073279 |
T |
 |
| Q |
214 |
gatagatggtaggcggggtaccaacatagttgattgatgtgttagttatagtaatgatgtcttccatgctagttttacactnnnnnnnnnttaaattctt |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41073278 |
gatagatggtaggcggggtaccaacatagttgattgatgtgttagttatcgtaatgatgtcttccatgctagttttacactaaaaaaaaattaaattctt |
41073179 |
T |
 |
| Q |
314 |
ctaaatattagatgcacaagataaggatataatgtccatag |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41073178 |
ctaaatattagatgcacaagataaggatataatgtccatag |
41073138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University