View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1468_high_12 (Length: 293)
Name: NF1468_high_12
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1468_high_12 |
 |  |
|
| [»] scaffold0142 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 44 - 181
Target Start/End: Complemental strand, 17365527 - 17365390
Alignment:
| Q |
44 |
gaatggatttataaacaaaatggaaccaagaagggtaattgggttcaaaagacaaggtgaagtctgcactaggtaatgctgggaatcttacccaataaaa |
143 |
Q |
| |
|
|||||| |||||| ||||||||||||||| |||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
17365527 |
gaatggctttatagccaaaatggaaccaaggagggtagttgggttcgaaagacaaagtgaagtctgcactaggtaatgctgggaatcttacgtagtaaaa |
17365428 |
T |
 |
| Q |
144 |
tggtaaagccattttgtatttggctagtacattgttca |
181 |
Q |
| |
|
|| |||||||||||||||| |||||||| | ||||||| |
|
|
| T |
17365427 |
tgctaaagccattttgtatctggctagtgcgttgttca |
17365390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 282
Target Start/End: Complemental strand, 17365219 - 17365142
Alignment:
| Q |
205 |
tgttctgcaaagaaggaaaagcactaatcagtttagtgcgaaatgttggttcatcaacaaggttggtgaagtagtatt |
282 |
Q |
| |
|
||||||||||||||||||| ||| | |||| ||| || |||||| ||| ||||||| ||||||| |||||||||||| |
|
|
| T |
17365219 |
tgttctgcaaagaaggaaacgcattgatcaattttgtccgaaatactggctcatcaataaggttgttgaagtagtatt |
17365142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0142 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0142
Description:
Target: scaffold0142; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 12511 - 12426
Alignment:
| Q |
44 |
gaatggatttataaacaaaatggaaccaagaagggtaattgggttcaaaagacaaggtgaagtctgcactaggtaatgctgggaat |
129 |
Q |
| |
|
||||||||||||| ||||||| ||||||| ||| || | ||||| |||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
12511 |
gaatggatttatagccaaaatgaaaccaaggaggatagcttggttcgaaagacaaagtgaagtctgcactaggcaatgctgggaat |
12426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 270
Target Start/End: Complemental strand, 23006937 - 23006849
Alignment:
| Q |
182 |
catacctttagttttcttcgatatgttctgcaaagaaggaaaagcactaatcagtttagtgcgaaatgttggttcatcaacaaggttgg |
270 |
Q |
| |
|
|||||||||| ||| |||||| || |||||||||||||||||||| | |||| || || ||||||| |||||| || |||||||||| |
|
|
| T |
23006937 |
catacctttattttccttcgacttgctctgcaaagaaggaaaagcagtgatcaagttggtacgaaatgctggttcgtcgacaaggttgg |
23006849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University