View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1468_high_20 (Length: 252)
Name: NF1468_high_20
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1468_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 27 - 242
Target Start/End: Original strand, 1940095 - 1940310
Alignment:
| Q |
27 |
tatatgataatagggatggaagtgtgatatatggaagcaatcaagaagttttgaacaaagtgaggactttcaaagatggtaaaatcaaaatatcaaagga |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1940095 |
tatatgataatagggatggaagtgtgatatatggaagcaatcaagaagttttggacaaagtgaggactttcaaagatggtaaaatcaaaatatcaaagga |
1940194 |
T |
 |
| Q |
127 |
aggtgaacttcttcataatgaaaatggaacagcaatttcaggtgatgttcgcaatagttgggctggtgtctcaactttgcaggctctttttattcaagaa |
226 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||| | |||||| ||| |||| |
|
|
| T |
1940195 |
aggtgaacttcttcataatgaagatggaacagcaatttcaggtgacattcgtaatagttgggctggtgtcacaactttgcagaccctttttgttctagaa |
1940294 |
T |
 |
| Q |
227 |
cacaatgctgtctgtg |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
1940295 |
cacaatgctgtgtgtg |
1940310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 1954534 - 1954764
Alignment:
| Q |
1 |
ttacacatgagatgcatgaaactatatatatgataatagggatggaagtgtgatatatggaagcaatcaagaagttttgaacaaagtgaggactttcaaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1954534 |
ttacacatgacatgcatgaaactata----tgataatagggatggaagtgtgatatatggaagcaatcaagaagttttgaacaaagtgagaactttcaaa |
1954629 |
T |
 |
| Q |
101 |
gatggtaaaatcaaaatatcaaaggaaggtgaacttcttcataatgaaaatggaacagcaatttcaggtgatgttcgcaatagttgggctggtgtctcaa |
200 |
Q |
| |
|
||||| || | ||||||| | | || ||| ||| || |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1954630 |
gatgggaagttaaaaatattagacgatggtacccttaagcaaaatgaaaatggagtagcaatttcaggtgacgttcgcaatagttgggctggtgtctcaa |
1954729 |
T |
 |
| Q |
201 |
ctttgcaggctctttttattcaagaacacaatgct |
235 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1954730 |
ctttgcaggctctctttattcaagaacacaatgct |
1954764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 38 - 242
Target Start/End: Original strand, 1925776 - 1925983
Alignment:
| Q |
38 |
agggatggaagtgtgatatatggaagcaatcaagaagttttgaacaaagtgaggactttcaaagatggtaaaatcaaaatatcaaaggaagg---tgaac |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||| |||||| | |||||||||||| | ||||||| || | ||||||||||||||||| | | | |
|
|
| T |
1925776 |
agggatggaagtgtgatatatggaagcaatgatgaaattttgacccaagtgaggacttcccaagatgggaagttaaaaatatcaaaggaaggaaatcatc |
1925875 |
T |
 |
| Q |
135 |
ttcttcataatgaaaatggaacagcaatttcaggtgatgttcgcaatagttgggctggtgtctcaactttgcaggctctttttattcaagaacacaatgc |
234 |
Q |
| |
|
|||| || || ||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
1925876 |
ttctacaaaacgaagatggagttgcaatttcaggtgatgttcgcaatagttgggctggtgtttcaactttgcaagcccttttcattcaagaacacaatgc |
1925975 |
T |
 |
| Q |
235 |
tgtctgtg |
242 |
Q |
| |
|
||| |||| |
|
|
| T |
1925976 |
tgtttgtg |
1925983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University