View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1468_high_28 (Length: 236)

Name: NF1468_high_28
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1468_high_28
NF1468_high_28
[»] chr1 (1 HSPs)
chr1 (1-207)||(40473613-40473819)


Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 40473613 - 40473819
Alignment:
1 tgactccccatggagttggagcctggttttgatcaagtctatggggaaagttgtggactcggccaccattgccgataatgatgttagtaaaatctttgta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
40473613 tgactccccatggagttggagcctggttttgatcaagtctatgggaaaagttgtggactcggccaccattgccgataatgatgttagcaaaatctttgta 40473712  T
101 tgagtattgtcaacttcattgcctgatttcattggtacatacaagaaaacccaactcgccaaaataaaatatgcacggggctggctggctggctattcta 200  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40473713 tgagtattgtcaacttgattgcctgatttcattggtacatacaagaaaacccaactcgccaaaataaaatatgcacggggctggctggctggctattcta 40473812  T
201 atacaat 207  Q
    | |||||    
40473813 agacaat 40473819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University