View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1468_low_10 (Length: 313)
Name: NF1468_low_10
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1468_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 297
Target Start/End: Complemental strand, 45214250 - 45213966
Alignment:
| Q |
11 |
caaaggtaggagtcatttttgatatcgctctcaaccacagatgaagatgtcgttcctt-cccatatatttatcatatcgattttgttttcccaatgttga |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45214250 |
caaaggtgggagtcatttttgatatcgctctcaaccacagatggagatgtcgttcctttcccatatatttatcatatcgattttgttttcccaatgttga |
45214151 |
T |
 |
| Q |
110 |
agagcatgatagtgatcgaagttcctccaatatgttcaatattaacgcatgaaaaagagatatgatagttgtcctctaactcacctttgcacaacacgct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
45214150 |
agagcatgatagtgatcgaagttcctccaatatgttcaatattaacgcatcaaaaagagatatgatagttgtcctctaactcaccttcgcacaaca--ct |
45214053 |
T |
 |
| Q |
210 |
tgttcatgaacattttacaaacgccaaataatttatttattttttactttaagcaaaacgttttccttccacattccttgccacaaac |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45214052 |
tgttcatgaacattttacaaacgccaaataatttatat-ttttttactttaggcaaaacgttttccttccacattccttgccacaaac |
45213966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University