View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1468_low_11 (Length: 312)
Name: NF1468_low_11
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1468_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 16 - 295
Target Start/End: Complemental strand, 35036407 - 35036128
Alignment:
| Q |
16 |
atgtcgatctaagaatatattatggcattaggtttattagaaatagagattgtaaaaggttgtttatagaaaggataaataaaatgaaaacgccatgaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35036407 |
atgtcgatctaagaatatattatggcattaggtttattagaaatagagattgtaaaaggttgtttatagaaaggataaataaaatgaaaacgccatgaac |
35036308 |
T |
 |
| Q |
116 |
atgtatcttggaattcattgtatattatgtcttatgagagtcgaatcatgttttcattgcacacttgcatttatataggaataaattgtaatgtcctctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35036307 |
atgtatcttggaattcattgtatattatgtcttatgagagtcgaatcatgttttcattgcacacttgcatttatataggaataaattgtaatgtcctctc |
35036208 |
T |
 |
| Q |
216 |
tagaggatagtaattctagcaatctccgatttgtatccgccagatacaaaatcagtcttttgattgtaattggtccaata |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35036207 |
tagaggatagtaattctagcaatctccgatttgtatccgccagatacaaaatcagtcttttgattgtaattggtcgaata |
35036128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University