View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1468_low_15 (Length: 292)
Name: NF1468_low_15
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1468_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 45562286 - 45562561
Alignment:
| Q |
1 |
caccgagacatcaaaccaaacaacatacttctagactctgatatggagcctcacattgccgactttggtattgccaaacttctggaccagtcttctacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45562286 |
caccgagacatcaaaccaaacaacatacttctagactctgatatggagcctcacattgccgactttggtattgccaaacttctggaccagtcttctacat |
45562385 |
T |
|
| Q |
101 |
caaacccttccttatctgtgccgggcacaattggttatattgcaccaggtaactaactattgattgaatgtttcttttcttttcaaaattctcatatgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45562386 |
caaacccttccttatctgtgccgggcacaattggttatattgcaccaggtaactaactattgattgaatgtttcttttcttttcaaaattctcatatgga |
45562485 |
T |
|
| Q |
201 |
tgatcaacatgtttttgttggcttgtgacagagaatgcttatacaacagtaagtagtagggagtgtgatgtgtaca |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45562486 |
tgattaacatgtttttgttggcttgtgacagagaatgcttatacaacagtaagtagtagggagtgtgatgtgtaca |
45562561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University