View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1468_low_18 (Length: 271)
Name: NF1468_low_18
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1468_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 259
Target Start/End: Original strand, 25179713 - 25179953
Alignment:
| Q |
19 |
cacaactcatcattttctcttttgggtgtgtttgtgtttcacttttgggttatagatagatgaaactagagaagcacaaaaacaaagagggattggaaga |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25179713 |
cacaactcatcattttttcttttgggtgtgtttgtgtttcacttttgggttatagatagatgaaactagagaagcacaaaaacaaagagggattggaaga |
25179812 |
T |
 |
| Q |
119 |
aggatatagtgtagcaattgtagtgtgattgagaggaaccaagaatgtgctttatatagataagagcacgaggtataattaatttcggcgccgtgttcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25179813 |
aggatatagtgtagcaattgtagtgtgattgagaggaaccaagaatgtgctttatatagataagagcacgaggtataattaatttcggcgccgtgttcaa |
25179912 |
T |
 |
| Q |
219 |
attgagttgcaagtggattgtgctatagtattaattttctt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25179913 |
attgagttgcaagtggattgtgctatagtattaattttctt |
25179953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University