View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1468_low_36 (Length: 228)
Name: NF1468_low_36
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1468_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 61 - 161
Target Start/End: Original strand, 275836 - 275936
Alignment:
| Q |
61 |
tatcatatgacgtgtattggatttatagataactttaattaattaaataaaatacaaaatggaatcaactattaaaatattattgcacttgaaaccatat |
160 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| || |||| |
|
|
| T |
275836 |
tatcatatgatgtgtattagatttacagataactttaattaattaaataaaatacaaaatggaatcaattattaaaatagtattgcacttgagactatat |
275935 |
T |
|
| Q |
161 |
a |
161 |
Q |
| |
|
| |
|
|
| T |
275936 |
a |
275936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 114
Target Start/End: Complemental strand, 46662972 - 46662938
Alignment:
| Q |
80 |
gatttatagataactttaattaattaaataaaata |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46662972 |
gatttatggataactttaattaattaaataaaata |
46662938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University