View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1468_low_38 (Length: 205)
Name: NF1468_low_38
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1468_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 47 - 189
Target Start/End: Original strand, 23262854 - 23262996
Alignment:
| Q |
47 |
caagtttggattcgaattatgaacctcccgcaagagtattagagaccaacattgctttttgaaattgcatctagtgtaggcgcccctctttccattgatg |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
23262854 |
caagtttggattcgaattatgaacctcccgcaagagtattagagaccaacattgctttttgaaattgcatctagtgtggacgcccctctttccattgatg |
23262953 |
T |
 |
| Q |
147 |
aatccacaaaaaaccgtctacatggccactatgtacgtatttt |
189 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23262954 |
aatccacaaaaaaccgtctacttggccactatgtacgtatttt |
23262996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 47 - 159
Target Start/End: Complemental strand, 9880760 - 9880646
Alignment:
| Q |
47 |
caagtttggattcgaattatgaacctcccgcaagagtattagagaccaacattgctttttgaaattgcatctagtgtaggcgccc--ctctttccattga |
144 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| ||| |||||||||||| |||||||||||| | |||||| | ||| ||| ||||||||||||| |
|
|
| T |
9880760 |
caagtttggattcaaattatgaacctcccccaagagcattggagaccaacatttctttttgaaattacttctagtttgggcacccctctctttccattga |
9880661 |
T |
 |
| Q |
145 |
tgaatccacaaaaaa |
159 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9880660 |
tgaatccacaaaaaa |
9880646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University