View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14691_high_14 (Length: 306)
Name: NF14691_high_14
Description: NF14691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14691_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 11 - 273
Target Start/End: Original strand, 24087582 - 24087836
Alignment:
| Q |
11 |
cacagacgtggaaaccattgctttttggagtcttcacaaaactgaagagaaagactgaaagagagaagaaagacttgtttattctgtatcttccaaaatt |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24087582 |
cacagacgtggaaaccatttctttttggagtcttcacaaaactgaagagaaaga--------gagaagaaagacttgtttattctgtatcttccaaaatt |
24087673 |
T |
 |
| Q |
111 |
accctttgttttctcccctttcattcgtttagnnnnnnnnnnnnnnnnnaactaattatgccagcacatgatattaccgtatgaaaataataagaaagaa |
210 |
Q |
| |
|
|||||||||||||||| ||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24087674 |
accctttgttttctcctcttccatttgtttagtttttttttttttttttaactaattatgccagcacatgatattaccgtatgaaaataataagaaagaa |
24087773 |
T |
 |
| Q |
211 |
atatcaacacatgatgaatccaacataccgtaacatttttattgagacaaaaataagttacta |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24087774 |
atatcaacacatgatgaatccaacataccgtaacatttttattgagacaaaaataagttacta |
24087836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University