View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14691_high_20 (Length: 239)
Name: NF14691_high_20
Description: NF14691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14691_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 35 - 179
Target Start/End: Complemental strand, 29800359 - 29800215
Alignment:
| Q |
35 |
cacgttgatctttgttggaagtctattttgaattagcctccaagcaaatgatgacaacttaagagaaacttatttgttccaagtcaagttgtgacgaggt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29800359 |
cacgttgatctttgttggaagtctattttgaattagcctccaaacaaatgatgacaacttaagagaaacttatttgttccaagtcaagttgtgacgaggt |
29800260 |
T |
 |
| Q |
135 |
aaaggctcgttgtcaaaaagcatgtgataaactcctttggtataa |
179 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29800259 |
aaaggctcattgtcaaaaagcatgtgataaactcctttggtataa |
29800215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University