View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14691_low_16 (Length: 291)
Name: NF14691_low_16
Description: NF14691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14691_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 24337839 - 24337648
Alignment:
| Q |
16 |
atgaatttatgttaaaaaatgaaactttattatatttcaaaaactgggttgttgnnnnnnnctactgaaagtgaccagtgaagtgagnnnnnnnntttgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
24337839 |
atgaatttatgttaaaaaatgaaactttattatatttcaaaaactgggttgttgtttttttctactgaaagtgaccagtgaagtgagaaaaaaaatttgt |
24337740 |
T |
 |
| Q |
116 |
cacaccattatcagagaggttgtgatgatttgatttgatatgagaaggccaccagcatagagagagtttagagcaacgagctcccattggtg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24337739 |
cacaccattatcagagaggttgtgatgatttgatttgatatgagaaggccaccagcatagagagagtttagagcaacgagctcccattggtg |
24337648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 239 - 272
Target Start/End: Complemental strand, 24337616 - 24337583
Alignment:
| Q |
239 |
ttcttttgcttctgtgtgttgtgtcactgtaaca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24337616 |
ttcttttgcttctgtgtgttgtgtcactgtaaca |
24337583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University