View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14691_low_24 (Length: 237)
Name: NF14691_low_24
Description: NF14691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14691_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 5 - 199
Target Start/End: Complemental strand, 50606340 - 50606148
Alignment:
| Q |
5 |
tggtcggatttcgaactccaaatttttcacttatttaacttaagaggtgactctttaacct-gacaatttgacctaaaaatatattaaattaaattctta |
103 |
Q |
| |
|
|||||| |||| ||| | |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50606340 |
tggtcgaattttgaaattcaaatttttcacttatttaatttaagaggtgactctttaaccttgacaatttgacctaaaaatatattaaattaaattctta |
50606241 |
T |
|
| Q |
104 |
aaacattttatatagataatctatttttataattgtttccggcaaccgcaataaatggcataatgtgtctctactcttttggttggacaatcgggt |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50606240 |
aaacattttatat---taatctatttttataattgtttccggcaaccgcaataaatggcataatgtgtctctactcttttggttggacaatcgggt |
50606148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University