View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14691_low_25 (Length: 231)
Name: NF14691_low_25
Description: NF14691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14691_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 48 - 96
Target Start/End: Original strand, 31019568 - 31019615
Alignment:
| Q |
48 |
aatacggttctgccaacatatttactttacttttcatcacaccataatt |
96 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31019568 |
aatacggttctgccaacat-tttactttacttttcatcacaccataatt |
31019615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 131
Target Start/End: Complemental strand, 31019547 - 31019494
Alignment:
| Q |
76 |
acttttcatcacaccataattataattaatttaaaatcttgtggcaatacttatca |
131 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
31019547 |
actttacatcacaccataattata-ttaatttaaa-tcttgtggcaatacttatca |
31019494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University