View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14692_high_3 (Length: 391)
Name: NF14692_high_3
Description: NF14692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14692_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 1e-57; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 246 - 375
Target Start/End: Original strand, 24290565 - 24290694
Alignment:
| Q |
246 |
atatataaagctcaccaattgtcaaaaacagaaacacaacacgaaatagaaaacaaatattagacagtacaatgcaaacttcattatggaacctaaataa |
345 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24290565 |
atatataaagctcaccaattgtcagaaacagaaacacaacatgaaaaagaaaacaaatattagacagtacaatgcaaacttctttatggaacctaaataa |
24290664 |
T |
 |
| Q |
346 |
acttttccttcattgatgacagcaaagaga |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24290665 |
acttttccttcattgatgacagcaaagaga |
24290694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 24281386 - 24281459
Alignment:
| Q |
1 |
ttatacaaacacatgaaaattttcttatctctgtaataattctttgatatcatatccttgcaactgtgtatcaa |
74 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24281386 |
ttatacaaacacatgaaaattttcctatctctgcaataattctttgatatcatatccttgcaactgtgaatcaa |
24281459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 82 - 152
Target Start/End: Original strand, 24290400 - 24290470
Alignment:
| Q |
82 |
ttattaacatcaacaccgataaactcgtgttcttttgtacaaacaatatattttgtaagctcaagcttatg |
152 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
24290400 |
ttattaacatcaacaccaataaactcgtgttcttttgtacataaaatatattttgtaagctcaagcttatg |
24290470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 148 - 208
Target Start/End: Original strand, 24290493 - 24290553
Alignment:
| Q |
148 |
ttatgaaccacaagtttagaccataaaaaatatctaaaccaaccccctaccaacccatcca |
208 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24290493 |
ttatgaaccaaaagtttagaccatacaaaatatctaaaccaaccccctaccaacccatcca |
24290553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 15 - 71
Target Start/End: Original strand, 24288218 - 24288274
Alignment:
| Q |
15 |
gaaaattttcttatctctgtaataattctttgatatcatatccttgcaactgtgtat |
71 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24288218 |
gaaaattttcctatctctgcaataattctttgatatcatatccttgcaactgtgtat |
24288274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University