View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14692_low_7 (Length: 224)
Name: NF14692_low_7
Description: NF14692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14692_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 37429997 - 37430184
Alignment:
| Q |
18 |
atgaatacattgcagaagaagaggaagtgatagatgatgatgcttcatcattgttgaacaatcacaagagaaagatggataattctccagctaggcaacc |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37429997 |
atgaatacattgcagaagaaggggaagtgatagatgatgatgcttcatcattgttgaacaatcacaagagaaagatggataattctccagctaggcaacc |
37430096 |
T |
|
| Q |
118 |
agagatgaagaaacggctcagttgcagttatacgaccggatatagggagcccttcagcaggattttgtttcatccactaccataatat |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37430097 |
agagatgaagaaacggctcggttgcagttatacgaccggatatagggagcccttcagcgggattttgtttcatccactaccataatat |
37430184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 37435141 - 37435026
Alignment:
| Q |
18 |
atgaatacattgcagaagaagaggaagtgatagat--gatgatgcttcatcattgttgaacaatcacaagagaaagatggataattctccagctaggcaa |
115 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
37435141 |
atgaatacattgcagaagaaggggaggtgatagatatgatgatgcttcatcattgttgaacagtcacaaaagaaagatggataatcctccagctaggcaa |
37435042 |
T |
|
| Q |
116 |
ccagagatgaagaaac |
131 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37435041 |
ccagagatgaagaaac |
37435026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University