View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14693_high_12 (Length: 238)

Name: NF14693_high_12
Description: NF14693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14693_high_12
NF14693_high_12
[»] chr5 (1 HSPs)
chr5 (1-222)||(26026308-26026529)


Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 26026308 - 26026529
Alignment:
1 tgtcaataatatgaatgagttagagaggtcttgtttaatgacacaccataaaagtaatggtttggcttatcatcaatgtggtttacaactacaatagtca 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||    
26026308 tgtcaataataagaatgagttagagaggtcttgtttaatgacacaccataaaagtaatggtttggcttatcatcaatgttgtttacaactaaaatagtca 26026407  T
101 gggcttgagatcgttaaacttcgaagaatgaaatggattataccagtacggcgaaatatagacaacttaggaagagatggttttagattctatatgggaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
26026408 gggcttgagatcgttaaacttcgaagaatgaaatggattataccagtacggcaaaatatagacaacttaggaagagatggttttagattctatatgggaa 26026507  T
201 tgatgtttacagcttaaatatt 222  Q
    ||||||||||||||||||||||    
26026508 tgatgtttacagcttaaatatt 26026529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University