View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14693_low_13 (Length: 238)
Name: NF14693_low_13
Description: NF14693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14693_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 26026308 - 26026529
Alignment:
| Q |
1 |
tgtcaataatatgaatgagttagagaggtcttgtttaatgacacaccataaaagtaatggtttggcttatcatcaatgtggtttacaactacaatagtca |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
26026308 |
tgtcaataataagaatgagttagagaggtcttgtttaatgacacaccataaaagtaatggtttggcttatcatcaatgttgtttacaactaaaatagtca |
26026407 |
T |
 |
| Q |
101 |
gggcttgagatcgttaaacttcgaagaatgaaatggattataccagtacggcgaaatatagacaacttaggaagagatggttttagattctatatgggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26026408 |
gggcttgagatcgttaaacttcgaagaatgaaatggattataccagtacggcaaaatatagacaacttaggaagagatggttttagattctatatgggaa |
26026507 |
T |
 |
| Q |
201 |
tgatgtttacagcttaaatatt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26026508 |
tgatgtttacagcttaaatatt |
26026529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University