View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14694_high_11 (Length: 299)
Name: NF14694_high_11
Description: NF14694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14694_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 17 - 284
Target Start/End: Original strand, 29274669 - 29274936
Alignment:
| Q |
17 |
caaaggcagcaaaatttgcagtcgaaaacagtttaccagccagcgtaagaatctatggtagctatgatgaggttgtggaagattcaggtgtggatgcagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274669 |
caaaggcagcaaaatttgcagtcgaaaacagtttaccagccagcgtaagaatctatggtagctatgatgaggttgtggaagattcaggtgtggatgcagt |
29274768 |
T |
|
| Q |
117 |
gtacattcctctcccgactagtctgcacgtgaggtgggcggttgctgccgcgaataagaagaagcatgtgttggtggagaagccggcagcacttgatgtg |
216 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274769 |
gtacattcctctcccaacgagtctgcacgtgaggtgggcggttgctgctgcgaataagaagaagcatgtgttggtggagaagccggcagcacttgatgtg |
29274868 |
T |
|
| Q |
217 |
gcagagcttgatttgatcttagaagcttgtgaagccaatggcgtgcagtttatggatggttgtatgtg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274869 |
gcagagcttgatttgatcttagaagcttgtgaggccaatggcgtgcagtttatggatggttgtatgtg |
29274936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University