View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14694_high_12 (Length: 286)
Name: NF14694_high_12
Description: NF14694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14694_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 127 - 268
Target Start/End: Original strand, 38592421 - 38592562
Alignment:
| Q |
127 |
atagcatggtgcatacttttgttcatatgtgattgtcataatactttgcaacgtcttagattcaaattgaaaacttatggttcagcttatcaaccggtac |
226 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38592421 |
atagaatggtgcatacttttgttcatatgtgattgtcataatactttgcaacgtcttagattcaaattgaaaacttatggttcagcttatcaaccggtac |
38592520 |
T |
 |
| Q |
227 |
tccgatgaatgtttgtctttattgctttatttaggtcatatg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38592521 |
tccgatgaatgtttgtctttattgctttatttaggtcatatg |
38592562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 39
Target Start/End: Original strand, 38592310 - 38592339
Alignment:
| Q |
10 |
aatattgagaggaacaaaaattattctttt |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38592310 |
aatattgagaggaacaaaaattattctttt |
38592339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University