View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14694_high_13 (Length: 266)
Name: NF14694_high_13
Description: NF14694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14694_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 90 - 235
Target Start/End: Complemental strand, 31226412 - 31226267
Alignment:
| Q |
90 |
gatttactgctttcgataattgagattaagcacattaaatatgagatagatttcaatttccatgggaaaatgttcgacgcacctgaagtataatttgttc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31226412 |
gatttactgctttcgataattgagattaagcacattaaatatgagatagatttcaatttctatgggaaaatgttcgacgcacctgaagtataatttgttc |
31226313 |
T |
 |
| Q |
190 |
aaaatttagaaaaaataaatttaaaatagaatacaagcttaattag |
235 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31226312 |
aaaatttagaaaaaataaattaaaaatagaatacaagcttaattag |
31226267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 31226515 - 31226464
Alignment:
| Q |
1 |
taactatggtcttttaagttttcggtttagttacttggaatagattaatagt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31226515 |
taactatggtcttttaagttttcggtttagttgcttggaatagattaatagt |
31226464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University