View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14694_high_18 (Length: 206)

Name: NF14694_high_18
Description: NF14694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14694_high_18
NF14694_high_18
[»] chr1 (1 HSPs)
chr1 (18-194)||(47535030-47535206)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 47535206 - 47535030
Alignment:
18 acaatatatatggacttagccctaaactctgacccgtcttcactgacagtgtcatccgggtcgaccgcgaagaggactgtaggttgagagttgttgggtt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47535206 acaatatatatggacttagccctaaactctgacccgtcttcactgacagtgtcatccgggtcgaccgcgaagaggactgtaggttgagagttgttgggtt 47535107  T
118 ctatggtttgagttcgtggactagaccggtccaattttcgaccggaacgtattgcacgagccctggaccacaggttc 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
47535106 ctatggtttgagttcgtggactagaccggtccaattttcgaccggaacgtattgcacgagccctggaccaccggttc 47535030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University