View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14694_low_6 (Length: 430)
Name: NF14694_low_6
Description: NF14694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14694_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 3 - 356
Target Start/End: Original strand, 25594863 - 25595216
Alignment:
| Q |
3 |
gaaaagaaactctgaaatatgattggtcagtatgcgtggtgacacatcaaagtgccacgtcatacaacgacagcatataaagcctcgaagcatctagaca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25594863 |
gaaaagaaactctgaaatatgattggtcagtatgcgtggtgacacatcaaagtgccacgtcatacaacgacagcatataaagcctcgaagcatctagaca |
25594962 |
T |
 |
| Q |
103 |
ttcttcccgcgaacttatttacacgaacactccgatcaattccgtcaccgttacgttaaaacaccgttctcagttttgattccgtcaccgtcacgatgac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25594963 |
ttcttcccgcgaacttatttacacgaacactccgatcaattccgtcaccgttacgttaaaacaccgttctcagtttcgattccgtcaccgtcacgatgac |
25595062 |
T |
 |
| Q |
203 |
ccgttcagccaccacattgatcgtcaccgtcgccgccttgtgtttccttttacaatccgaagccaaaacaatcgacccgtacaaggttactttctttttt |
302 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25595063 |
cctttcagccaccacattgatcgtcaccttcgccgccttgtgtttccttttacaatccgaagccaaaacaatcgacccgtacaaggttactttctttttt |
25595162 |
T |
 |
| Q |
303 |
aatttgtgaaacttttattgggttttataatttgaggttaaaatagcggaaagg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25595163 |
aatttgtgaaacttttattgggttttataatttgaggttaaaatagcggaaagg |
25595216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University