View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14694_low_9 (Length: 354)
Name: NF14694_low_9
Description: NF14694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14694_low_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 28 - 354
Target Start/End: Complemental strand, 10008505 - 10008180
Alignment:
| Q |
28 |
aggtctccggcaaatgtcttatggtcttacccttggaccggtcgtggatttaatcccaatttgaagcgcaaatgtcaagtatatccatttcaatttatca |
127 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10008505 |
aggtctccggcgaatgtcttatggtcttactcttggaccggtcctggatttaatcccaatttgaagcgcaaatgtcaagtatatccatttcaatttatca |
10008406 |
T |
 |
| Q |
128 |
tccaaagctttatgagaaacacgagctctgaaatattttttgagcaaaacaagctctgaattatgattggcacatttaattaagattagtttatcccttt |
227 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10008405 |
tcgaaagctttatgagaaacacgagctctgaaatatttttttagcaaaacaagctctgaattatgattggcacatttaattaagattagtttatcccttt |
10008306 |
T |
 |
| Q |
228 |
gaattggcagtcattttgtttatttatacatgtcattaaggttactttttaatgttaacttaaaactcagaaatactgtatcactcattttgaatatatt |
327 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10008305 |
gaattggcagtcattttgtttatttat-gatgtcattaaggttactttttaatgttaacttaaaactcagaaatactgtatcactcattttgaatatatt |
10008207 |
T |
 |
| Q |
328 |
tggtatccctattcctatggagttgca |
354 |
Q |
| |
|
||||||||||| ||||| ||||||||| |
|
|
| T |
10008206 |
tggtatccctagtcctagggagttgca |
10008180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University