View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_high_13 (Length: 357)
Name: NF14695_high_13
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 108 - 340
Target Start/End: Complemental strand, 38911249 - 38911017
Alignment:
| Q |
108 |
gggttctggttcatactgacctgaaaaattagggcatcggaaaattgctcaagacggagatagatttcgccgagggattgacaagttgtgactaagtgat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38911249 |
gggttctggttcatactgacctgaaaaattagggcatcggaaaattgctcaagacggagatagatttcgccgagggattgacaagttgtgactaaatgat |
38911150 |
T |
|
| Q |
208 |
tctccgataagtacttaagcgaaacttcgtagtcgattcggagccatttgagagctttaacgtattcacctctgttcttgagtatatcgccgatgacgtt |
307 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38911149 |
tctccgataagtacttaagcgaaatttcgtagtcgattcggagccatttgagagctttaacgtattcacctctgttcttgagtatatcgccgatgacgtt |
38911050 |
T |
|
| Q |
308 |
tgcccaacgcgcttcttcgcggtggttaccttc |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38911049 |
tgcccaacgcgcttcttcgcggtggttaccttc |
38911017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 38911339 - 38911311
Alignment:
| Q |
18 |
gctagatctaaatgtttcttctacaatcc |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38911339 |
gctagatctaaatgtttcttctacaatcc |
38911311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University