View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_high_14 (Length: 347)
Name: NF14695_high_14
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 164 - 334
Target Start/End: Complemental strand, 38654989 - 38654819
Alignment:
| Q |
164 |
aagtacattattaggtctcaagccaacgtcatcatgtcaatccaactttttaatattagaagggcatatcaattaaactcttttttaattttggacaaaa |
263 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38654989 |
aagtacactattaggtctcaagccaacgtcatcatatcaatccaactttttaatattagaagggcatatcaattaaactcttttttaattttggacaaaa |
38654890 |
T |
 |
| Q |
264 |
tcacgtcagtttaaaggagtcgagaagtcatgggtatcgacaattaagtccagtgaggtagatgagtctga |
334 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38654889 |
tcacgtcagttttaaggagtcgagaagtcatgggtatcgacaattaagtccagtgaggtagatgagtctga |
38654819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University