View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_low_29 (Length: 301)
Name: NF14695_low_29
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 4e-32; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 202 - 284
Target Start/End: Complemental strand, 50614188 - 50614107
Alignment:
| Q |
202 |
gttgaggaatgaagagtacttgaataaaaatcagttggtcaaactcattgtttgcaaaggtgtaagtgtgtggagatcattcc |
284 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50614188 |
gttgaggaatgaagagtacttcaataaaa-tcagttggtcaaactcattgtttgcaaaggtgtaagtgtgtggagatcattcc |
50614107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 15 - 79
Target Start/End: Complemental strand, 50614338 - 50614274
Alignment:
| Q |
15 |
tgagaagacattaaagctaaagcttagcatatcaaacaatcaacttgcagagatcgtgaaaaaac |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
50614338 |
tgagaagacattaaagctaaagcttagcatatcaaacaatcaacttgcagacatcatgaaaaaac |
50614274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 132 - 173
Target Start/End: Complemental strand, 50614227 - 50614186
Alignment:
| Q |
132 |
aacattctaaagtttcaaaaataaggattggagcaaactgtt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50614227 |
aacattctaaagtttcaaaaataaggattggagcaaactgtt |
50614186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University