View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_low_34 (Length: 249)
Name: NF14695_low_34
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 33499554 - 33499722
Alignment:
| Q |
1 |
tcttctataaatagtttggttaatccttatatgt--ccttccctttgctatctacttcctctcttacttgcttacatgcgtagtg--ctttctcttaatc |
96 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33499554 |
tcttctataaatagtttggttaaaccttatatgtgtccttccctttgctatctacttcctctcttacttgcttacatgcgtagtgtgctttctcttaatc |
33499653 |
T |
 |
| Q |
97 |
ttgtaacttattccaagcactctcatttttaccaaaccctaatttcacattgtatttatctgattccca |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499654 |
ttgtaacttattccaagcactctcatttttaccaaaccctaatttcacattgtatttatctgattccca |
33499722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 212 - 243
Target Start/End: Original strand, 33499719 - 33499750
Alignment:
| Q |
212 |
cccaggatctccttcttattccttctcctttg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33499719 |
cccaggatctccttcttattccttctcctttg |
33499750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University