View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_low_36 (Length: 243)
Name: NF14695_low_36
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 36000284 - 36000496
Alignment:
| Q |
19 |
attagtcattactagagttcttacatgaccattgacatacttgaaaagtgannnnnnnn---acacaaacaattattacttttaggccttataaacattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36000284 |
attagtcattactagagttcttacatgaccattgacttacttgaaaagtgatttttttttttacacaaacaattattacttttaggccttataaacattt |
36000383 |
T |
|
| Q |
116 |
tcttttactttgatatgctgatatgcatactcagcatcaagaacccttgttgaaatgtacttcgtaaacagttacaatgcatgtgggataactctgcaac |
215 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36000384 |
tcttttactttgat--------atgcatactcaacatcaagaacccttgttgaaatctactttgtaaacagttacaatgcatgtgggataactctgcaac |
36000475 |
T |
|
| Q |
216 |
cttgttagctaataacttcat |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36000476 |
cttgttagctaataacttcat |
36000496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University