View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_low_37 (Length: 243)
Name: NF14695_low_37
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 30 - 141
Target Start/End: Original strand, 10091721 - 10091832
Alignment:
| Q |
30 |
caataataacgcatagtcactgcaaatgaagtgttaatgctttatgcttgaaatttgcacatttatcttcgataggaagccaatatggtgagatagattt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10091721 |
caataataacgcatagtcactgcaaatgaagtgttaatgctttatgcttgaaatttgcacatttatcttcgataggaagccaatatggtgagatagattt |
10091820 |
T |
|
| Q |
130 |
tgagttcttagg |
141 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10091821 |
tgagttcttagg |
10091832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 86 - 151
Target Start/End: Original strand, 43347266 - 43347331
Alignment:
| Q |
86 |
gcacatttatcttcgataggaagccaatatggtgagatagattttgagttcttaggaaacagtaca |
151 |
Q |
| |
|
||||| |||||||||| |||||||||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
43347266 |
gcacagttatcttcgacaggaagccaacatgatgagatagattttgagttcttaggtaacagtaca |
43347331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 93 - 144
Target Start/End: Original strand, 33449489 - 33449540
Alignment:
| Q |
93 |
tatcttcgataggaagccaatatggtgagatagattttgagttcttaggaaa |
144 |
Q |
| |
|
||||||| |||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
33449489 |
tatcttccataggaagccaacatgacgagctagattttgagttcttaggaaa |
33449540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 147
Target Start/End: Complemental strand, 10380640 - 10380611
Alignment:
| Q |
118 |
tgagatagattttgagttcttaggaaacag |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10380640 |
tgagatagattttgagttcttaggaaacag |
10380611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 147
Target Start/End: Original strand, 10410333 - 10410362
Alignment:
| Q |
118 |
tgagatagattttgagttcttaggaaacag |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10410333 |
tgagatagattttgagttcttaggaaacag |
10410362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University