View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_low_38 (Length: 239)
Name: NF14695_low_38
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 122
Target Start/End: Complemental strand, 36276468 - 36276364
Alignment:
| Q |
18 |
tctatcaagcagaagacaaaaataaccatacagagcttaattggcttttccaaaataatactgtagttatttcaagatcaggatgaaatcaaactatgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276468 |
tctatcaagcagaagacaaaaataaccatacagagcttaattggcttttccaaaataatactgtagttatttcaagatcaggatgaaatcaaactatgga |
36276369 |
T |
 |
| Q |
118 |
caacc |
122 |
Q |
| |
|
||||| |
|
|
| T |
36276368 |
caacc |
36276364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 178 - 237
Target Start/End: Complemental strand, 36276314 - 36276255
Alignment:
| Q |
178 |
aacttttatttggctgccccatatgtttaaccaatcagttgaatgtcttaatataatatt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276314 |
aacttttatttggctgccccatatgtttaaccaatcagttgaatgtcttaatataatatt |
36276255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University