View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_low_39 (Length: 238)
Name: NF14695_low_39
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45344701 - 45344486
Alignment:
| Q |
1 |
taaatatttccacacaatactgccaggttagtttggaatatggaagcacatttgggattgtaattggatatttcaattgcaattatcttgattcatgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45344701 |
taaatatttccacacaatactgccaggttagtttggaatatggaagcacatttgggattgtaattggatatttcaattgcaattatcttgattcatgttt |
45344602 |
T |
|
| Q |
101 |
gggaatatacaatagcttgaatctggactatttttgtggaactttgtatgaaggaatattttacatagcatccccccatgaatgtcgataaatctattgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
45344601 |
gggaatatacaatagcttgaatctggactatttttgtggaactttgtatgaaggaa-----tacatagcatccacccatgaatgtcgataaatctatttc |
45344507 |
T |
|
| Q |
201 |
ttttttcaattctgatcttat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45344506 |
ttttttcaattctgatcttat |
45344486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University