View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_low_43 (Length: 223)
Name: NF14695_low_43
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 81 - 212
Target Start/End: Original strand, 51119458 - 51119583
Alignment:
| Q |
81 |
gtagttgaattctgcagcaagtgatgttgtggaagtgaagcccaagcccaaccaatatggctataagtggcgcctccttttgtcttacgatggaacccga |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51119458 |
gtagttgaattctgcagcaagtgatgttgtggaagtgaagc------ccaaccaagatggctataagtggcgcctccttttgtcttacgatggaacccga |
51119551 |
T |
 |
| Q |
181 |
tatgcaggcaatcatcatttttctctcttcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
51119552 |
tatgcaggcaatcatcatttttctcttttcat |
51119583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University