View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14695_low_43 (Length: 223)

Name: NF14695_low_43
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14695_low_43
NF14695_low_43
[»] chr4 (1 HSPs)
chr4 (81-212)||(51119458-51119583)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 81 - 212
Target Start/End: Original strand, 51119458 - 51119583
Alignment:
81 gtagttgaattctgcagcaagtgatgttgtggaagtgaagcccaagcccaaccaatatggctataagtggcgcctccttttgtcttacgatggaacccga 180  Q
    |||||||||||||||||||||||||||||||||||||||||      |||||||| ||||||||||||||||||||||||||||||||||||||||||||    
51119458 gtagttgaattctgcagcaagtgatgttgtggaagtgaagc------ccaaccaagatggctataagtggcgcctccttttgtcttacgatggaacccga 51119551  T
181 tatgcaggcaatcatcatttttctctcttcat 212  Q
    |||||||||||||||||||||||||| |||||    
51119552 tatgcaggcaatcatcatttttctcttttcat 51119583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University